Transcript: Mouse NM_178164.3

Mus musculus polypyrimidine tract binding protein 3 (Ptbp3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptbp3 (230257)
Length:
6855
CDS:
269..1840

Additional Resources:

NCBI RefSeq record:
NM_178164.3
NBCI Gene record:
Ptbp3 (230257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178164.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306569 AGCCCTGTGCTCCGGATAATT pLKO_005 716 CDS 100% 15.000 21.000 N Ptbp3 n/a
2 TRCN0000348608 GCCCTGTGCTCCGGATAATTA pLKO_005 717 CDS 100% 15.000 21.000 N Ptbp3 n/a
3 TRCN0000109238 CCCGGCTCAAAGAATTTCCAA pLKO.1 1565 CDS 100% 3.000 4.200 N Ptbp3 n/a
4 TRCN0000364024 CATCTGACCTTCCCGTGAAAT pLKO_005 1834 CDS 100% 13.200 10.560 N Ptbp3 n/a
5 TRCN0000348609 GAAGCAGAGGTCATATCATTA pLKO_005 395 CDS 100% 13.200 10.560 N Ptbp3 n/a
6 TRCN0000109239 GCTGCTGTTACTATGATAAAT pLKO.1 497 CDS 100% 15.000 10.500 N Ptbp3 n/a
7 TRCN0000327080 GCTGCTGTTACTATGATAAAT pLKO_005 497 CDS 100% 15.000 10.500 N Ptbp3 n/a
8 TRCN0000306570 CCATTTGGCAAAGTAACTAAT pLKO_005 422 CDS 100% 13.200 9.240 N Ptbp3 n/a
9 TRCN0000338925 CCATTTGGCAAAGTAACTAAT pLKO_005 422 CDS 100% 13.200 9.240 N PTBP3 n/a
10 TRCN0000348546 TTTGGTGCACCGGGTATAATG pLKO_005 1064 CDS 100% 13.200 9.240 N Ptbp3 n/a
11 TRCN0000306533 CACCGAAGCAGAGGTCATATC pLKO_005 391 CDS 100% 10.800 7.560 N Ptbp3 n/a
12 TRCN0000109235 CCCGTGAAATTGTCTCCTTAT pLKO.1 1845 3UTR 100% 10.800 7.560 N Ptbp3 n/a
13 TRCN0000061785 CCTCAGAGTTTCCTTCTCAAA pLKO.1 1807 CDS 100% 4.950 3.465 N PTBP3 n/a
14 TRCN0000109237 CCTGACTTTATCACACCACAT pLKO.1 1280 CDS 100% 4.050 2.835 N Ptbp3 n/a
15 TRCN0000306571 TACCAGATATTTGCATCTATT pLKO_005 2335 3UTR 100% 0.000 0.000 N Ptbp3 n/a
16 TRCN0000109236 GCTCTTATTGAGCTTCACAAT pLKO.1 1763 CDS 100% 4.950 2.970 N Ptbp3 n/a
17 TRCN0000061784 CCAGCCTTAATGTGAAATATA pLKO.1 957 CDS 100% 15.000 10.500 N PTBP3 n/a
18 TRCN0000310715 TTTGGTGCACCGGGTATAATT pLKO_005 1064 CDS 100% 15.000 10.500 N PTBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178164.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11442 pDONR223 100% 84.7% 88.3% None (many diffs) n/a
Download CSV