Transcript: Human NM_178527.4

Homo sapiens solute carrier family 9 member C2 (putative) (SLC9C2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC9C2 (284525)
Length:
4410
CDS:
402..3776

Additional Resources:

NCBI RefSeq record:
NM_178527.4
NBCI Gene record:
SLC9C2 (284525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178527.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136354 GAGGATCGAATACATTCCTTT pLKO.1 1844 CDS 100% 4.950 6.930 N SLC9C2 n/a
2 TRCN0000136497 CGATTCTTTCTCTATCAGGAT pLKO.1 574 CDS 100% 2.640 2.112 N SLC9C2 n/a
3 TRCN0000136496 CCTTTGTTCAAGAGGCATTAT pLKO.1 2864 CDS 100% 13.200 9.240 N SLC9C2 n/a
4 TRCN0000429375 GGCCAATGGCAAGAGGTTTAA pLKO_005 2287 CDS 100% 13.200 9.240 N SLC9C2 n/a
5 TRCN0000136094 GCTGTAGGACTGAATTTAGAT pLKO.1 1242 CDS 100% 5.625 3.938 N SLC9C2 n/a
6 TRCN0000136146 GTCAGGTTAAAGACCAAACTA pLKO.1 3831 3UTR 100% 5.625 3.938 N SLC9C2 n/a
7 TRCN0000135234 CAAATTGTCTACCCTCTTCTA pLKO.1 636 CDS 100% 4.950 3.465 N SLC9C2 n/a
8 TRCN0000135223 CCATTTGTAAAGGAGGTGAAA pLKO.1 3079 CDS 100% 4.950 3.465 N SLC9C2 n/a
9 TRCN0000135947 GCATTATAGATCCTCTTCGTT pLKO.1 880 CDS 100% 3.000 2.100 N SLC9C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178527.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.