Transcript: Mouse NM_178661.4

Mus musculus cAMP responsive element binding protein 3-like 2 (Creb3l2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Creb3l2 (208647)
Length:
3318
CDS:
349..1914

Additional Resources:

NCBI RefSeq record:
NM_178661.4
NBCI Gene record:
Creb3l2 (208647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178661.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084449 CAGACGCTTATTCCTAAGATT pLKO.1 859 CDS 100% 5.625 7.875 N Creb3l2 n/a
2 TRCN0000084451 CCAGACGCTTATTCCTAAGAT pLKO.1 858 CDS 100% 5.625 7.875 N Creb3l2 n/a
3 TRCN0000331511 CCAGACGCTTATTCCTAAGAT pLKO_005 858 CDS 100% 5.625 7.875 N Creb3l2 n/a
4 TRCN0000084448 GCAGGCTTGTTTCCACCAATA pLKO.1 2151 3UTR 100% 10.800 8.640 N Creb3l2 n/a
5 TRCN0000331759 GCAGGCTTGTTTCCACCAATA pLKO_005 2151 3UTR 100% 10.800 8.640 N Creb3l2 n/a
6 TRCN0000084450 GTCTTGTTCAACTGAGAACTT pLKO.1 1329 CDS 100% 4.950 3.960 N Creb3l2 n/a
7 TRCN0000301786 GTCTTGTTCAACTGAGAACTT pLKO_005 1329 CDS 100% 4.950 3.960 N Creb3l2 n/a
8 TRCN0000084452 GCAAACTGGAAGGGAACGAAA pLKO.1 1847 CDS 100% 4.950 3.465 N Creb3l2 n/a
9 TRCN0000301785 GCAAACTGGAAGGGAACGAAA pLKO_005 1847 CDS 100% 4.950 3.465 N Creb3l2 n/a
10 TRCN0000016440 CCATCAAGACAGAGCCAATTA pLKO.1 719 CDS 100% 13.200 9.240 N CREB3L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178661.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.