Transcript: Mouse NM_178689.4

Mus musculus enolase 4 (Eno4), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Eno4 (226265)
Length:
2583
CDS:
33..1889

Additional Resources:

NCBI RefSeq record:
NM_178689.4
NBCI Gene record:
Eno4 (226265)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178689.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114552 CCTTCCATAATCGCCTTAATT pLKO.1 1341 CDS 100% 15.000 21.000 N Eno4 n/a
2 TRCN0000114555 CCAGCGATCCTCTCTACTTAA pLKO.1 796 CDS 100% 13.200 10.560 N Eno4 n/a
3 TRCN0000114553 GCAGCCGTCAACATTCTCTAT pLKO.1 845 CDS 100% 4.950 3.960 N Eno4 n/a
4 TRCN0000114551 CGCTCTGAACTCCACTTATAT pLKO.1 1976 3UTR 100% 15.000 10.500 N Eno4 n/a
5 TRCN0000114554 CCATCTTATCAACGGTAAGAA pLKO.1 1562 CDS 100% 0.563 0.394 N Eno4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178689.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.