Transcript: Mouse NM_178760.4

Mus musculus G protein-coupled receptor 107 (Gpr107), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gpr107 (277463)
Length:
3926
CDS:
44..1699

Additional Resources:

NCBI RefSeq record:
NM_178760.4
NBCI Gene record:
Gpr107 (277463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217105 CAAAGATGATGTGCGGCATAA pLKO.1 163 CDS 100% 10.800 15.120 N Gpr107 n/a
2 TRCN0000242106 TTCAGTCTGGATCGGACTAAG pLKO_005 296 CDS 100% 10.800 15.120 N Gpr107 n/a
3 TRCN0000194527 GCCTCATTCAGCCTGAATATT pLKO.1 752 CDS 100% 15.000 10.500 N Gpr107 n/a
4 TRCN0000242105 GTGTGGTCAATCAGGCATTTA pLKO_005 1298 CDS 100% 13.200 9.240 N Gpr107 n/a
5 TRCN0000242103 TAAGAGAAGGAATGATGTATT pLKO_005 895 CDS 100% 13.200 9.240 N Gpr107 n/a
6 TRCN0000242102 TGAAGGCTGGGCTGTTGTATA pLKO_005 1018 CDS 100% 13.200 9.240 N Gpr107 n/a
7 TRCN0000175996 GCTGTCAATGAAACTAGCTTA pLKO.1 1717 3UTR 100% 4.950 3.465 N Gpr107 n/a
8 TRCN0000242104 ATTTCGCCCAGCTTCAGATAA pLKO_005 1531 CDS 100% 13.200 7.920 N Gpr107 n/a
9 TRCN0000215874 CTGGATGAAGATGTGAATTAC pLKO.1 338 CDS 100% 13.200 7.920 N Gpr107 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.