Transcript: Mouse NM_178789.4

Mus musculus transmembrane protein 117 (Tmem117), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem117 (320709)
Length:
2781
CDS:
145..1689

Additional Resources:

NCBI RefSeq record:
NM_178789.4
NBCI Gene record:
Tmem117 (320709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178789.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181803 GCAAGGTAGATTAGCCGATTA pLKO.1 1945 3UTR 100% 10.800 15.120 N Tmem117 n/a
2 TRCN0000198380 GCTTATCTCATCACTGACTAT pLKO.1 556 CDS 100% 4.950 6.930 N Tmem117 n/a
3 TRCN0000178720 CGGAATTATCTTTCTCGTCTT pLKO.1 1059 CDS 100% 4.050 5.670 N Tmem117 n/a
4 TRCN0000182431 GATATGGGAATCACCCGAGAA pLKO.1 1477 CDS 100% 4.050 5.670 N Tmem117 n/a
5 TRCN0000198740 CCAGTCTATTTCACATGGGAT pLKO.1 2054 3UTR 100% 2.640 3.696 N Tmem117 n/a
6 TRCN0000198255 GCTTACATCTGAAGGAATCTA pLKO.1 1610 CDS 100% 5.625 4.500 N Tmem117 n/a
7 TRCN0000178628 CCGCAATGAAAGTTTCATGAA pLKO.1 585 CDS 100% 4.950 3.960 N Tmem117 n/a
8 TRCN0000415267 GCAACCTTGAGTGTAACTTTA pLKO_005 1718 3UTR 100% 13.200 9.240 N TMEM117 n/a
9 TRCN0000130692 CCTCACATGCAGTTCAAGATT pLKO.1 973 CDS 100% 5.625 3.938 N TMEM117 n/a
10 TRCN0000176760 CGCAATGAAAGTTTCATGAAA pLKO.1 586 CDS 100% 5.625 3.938 N Tmem117 n/a
11 TRCN0000177142 GCGTTAGGTAAAGAAATACAA pLKO.1 1779 3UTR 100% 5.625 3.938 N Tmem117 n/a
12 TRCN0000181737 GCTTACCTGGTCATCTTCTTT pLKO.1 199 CDS 100% 5.625 3.938 N Tmem117 n/a
13 TRCN0000178058 GCTCTCAAATGTATTGGCATT pLKO.1 2460 3UTR 100% 4.050 2.430 N Tmem117 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178789.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.