Transcript: Mouse NM_178848.3

Mus musculus sirtuin 5 (Sirt5), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sirt5 (68346)
Length:
1369
CDS:
46..978

Additional Resources:

NCBI RefSeq record:
NM_178848.3
NBCI Gene record:
Sirt5 (68346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092835 CGACAGATTCAGGTTTCATTT pLKO.1 891 CDS 100% 13.200 10.560 N Sirt5 n/a
2 TRCN0000092836 CGAGAACTATAGGAGTCCGAT pLKO.1 564 CDS 100% 2.640 2.112 N Sirt5 n/a
3 TRCN0000092837 AGTTCAAATATGGCAGACTTT pLKO.1 154 CDS 100% 4.950 3.465 N Sirt5 n/a
4 TRCN0000092834 CCAGTTGTGTTGTAGACGAAA pLKO.1 84 CDS 100% 4.950 3.465 N Sirt5 n/a
5 TRCN0000092833 GCAGACAATCTGTTACGTGAT pLKO.1 1114 3UTR 100% 4.050 2.835 N Sirt5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07880 pDONR223 98.4% 83.9% 86.1% None (many diffs) n/a
2 ccsbBroad304_07880 pLX_304 0% 83.9% 86.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV