Transcript: Human NM_178860.5

Homo sapiens seizure related 6 homolog (SEZ6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SEZ6 (124925)
Length:
4206
CDS:
165..3149

Additional Resources:

NCBI RefSeq record:
NM_178860.5
NBCI Gene record:
SEZ6 (124925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178860.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151016 GCAAACATCTTCACCCTAATA pLKO.1 3890 3UTR 100% 13.200 18.480 N SEZ6 n/a
2 TRCN0000156476 CGTAGCCACTTCAAGCTCTTT pLKO.1 2160 CDS 100% 4.950 6.930 N SEZ6 n/a
3 TRCN0000435064 GCGTTTGACAATCCAACTTAC pLKO_005 3087 CDS 100% 10.800 8.640 N SEZ6 n/a
4 TRCN0000154984 GAGACTTTCCTCCGATGTTTA pLKO.1 3859 3UTR 100% 13.200 9.240 N SEZ6 n/a
5 TRCN0000416118 TATGAGCCCTTTGTCAAATAC pLKO_005 1761 CDS 100% 13.200 9.240 N SEZ6 n/a
6 TRCN0000154733 GAGGCAGTAATTCTAGGAGAT pLKO.1 3719 3UTR 100% 4.050 2.835 N SEZ6 n/a
7 TRCN0000157171 GTGTTGTTGGTAGGAGGTGTA pLKO.1 2976 CDS 100% 4.050 2.835 N SEZ6 n/a
8 TRCN0000155797 CCATTTCCATTACCAAGCCTA pLKO.1 1202 CDS 100% 2.640 1.848 N SEZ6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178860.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.