Transcript: Human NM_178862.3

Homo sapiens STT3 oligosaccharyltransferase complex catalytic subunit B (STT3B), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
STT3B (201595)
Length:
4107
CDS:
75..2555

Additional Resources:

NCBI RefSeq record:
NM_178862.3
NBCI Gene record:
STT3B (201595)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093704 GCACCAAAGAACCCTCTAATT pLKO.1 2846 3UTR 100% 13.200 18.480 N Stt3b n/a
2 TRCN0000316744 GCACCAAAGAACCCTCTAATT pLKO_005 2846 3UTR 100% 13.200 18.480 N Stt3b n/a
3 TRCN0000139967 GCAGTATCTGAGAGACCGATT pLKO.1 1085 CDS 100% 4.050 5.670 N STT3B n/a
4 TRCN0000142443 GAGTAATGTCTTGGTGGGATT pLKO.1 1873 CDS 100% 4.050 3.240 N STT3B n/a
5 TRCN0000144463 CTGGCCTTATTCATTGGATTT pLKO.1 523 CDS 100% 10.800 7.560 N STT3B n/a
6 TRCN0000145241 GCACTTCAGTTCACATACTAT pLKO.1 759 CDS 100% 5.625 3.938 N STT3B n/a
7 TRCN0000141732 GCAGGTAAAGTGAGGAAACAT pLKO.1 1614 CDS 100% 5.625 3.938 N STT3B n/a
8 TRCN0000141004 CAGATGAACATGCACGAGTAA pLKO.1 1858 CDS 100% 4.950 3.465 N STT3B n/a
9 TRCN0000093708 CGAACACGTAATGCTGAGATT pLKO.1 2292 CDS 100% 4.950 3.465 N Stt3b n/a
10 TRCN0000141176 CGAACACGTAATGCTGAGATT pLKO.1 2292 CDS 100% 4.950 3.465 N STT3B n/a
11 TRCN0000316752 CGAACACGTAATGCTGAGATT pLKO_005 2292 CDS 100% 4.950 3.465 N Stt3b n/a
12 TRCN0000144945 GAAGAAGCCTTTACATCAGAA pLKO.1 2343 CDS 100% 4.950 3.465 N STT3B n/a
13 TRCN0000093707 GCTGGCCTTATTCATTGGATT pLKO.1 522 CDS 100% 4.950 3.465 N Stt3b n/a
14 TRCN0000142062 GCTGGCCTTATTCATTGGATT pLKO.1 522 CDS 100% 4.950 3.465 N STT3B n/a
15 TRCN0000316742 GCTGGCCTTATTCATTGGATT pLKO_005 522 CDS 100% 4.950 3.465 N Stt3b n/a
16 TRCN0000144282 CACTTTCTACATTGTGGGTTT pLKO.1 959 CDS 100% 4.050 2.835 N STT3B n/a
17 TRCN0000145170 GTTATTGGCTATTCTGGTGAT pLKO.1 2064 CDS 100% 4.050 2.835 N STT3B n/a
18 TRCN0000139592 CATCCCAAAGACATTCGGGAA pLKO.1 2130 CDS 100% 2.160 1.512 N STT3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13391 pDONR223 100% 27.1% 27.1% None 1_1803del;2465C>T n/a
2 ccsbBroad304_13391 pLX_304 0% 27.1% 27.1% V5 1_1803del;2465C>T n/a
Download CSV