Transcript: Human NM_178864.4

Homo sapiens neuronal PAS domain protein 4 (NPAS4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NPAS4 (266743)
Length:
3272
CDS:
146..2554

Additional Resources:

NCBI RefSeq record:
NM_178864.4
NBCI Gene record:
NPAS4 (266743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178864.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107570 CGTCGTCAAGTATGGCATATT pLKO.1 2572 3UTR 100% 13.200 18.480 N NPAS4 n/a
2 TRCN0000107574 GCAGGCAACAAACTCGTGCTT pLKO.1 629 CDS 100% 2.640 3.696 N NPAS4 n/a
3 TRCN0000433630 TGGCTGAGAGTGGAGATATTC pLKO_005 954 CDS 100% 13.200 9.240 N NPAS4 n/a
4 TRCN0000415807 GAGCGATCCCAGTTTCCATTT pLKO_005 2754 3UTR 100% 10.800 7.560 N NPAS4 n/a
5 TRCN0000419942 TGGGATTTCAAGCGGAGAATG pLKO_005 2809 3UTR 100% 10.800 7.560 N NPAS4 n/a
6 TRCN0000107571 CCTTCCCAGATCCACTAACTA pLKO.1 1572 CDS 100% 5.625 3.938 N NPAS4 n/a
7 TRCN0000107573 CTGCTTTGTAAATCATGGTAT pLKO.1 878 CDS 100% 4.950 3.465 N NPAS4 n/a
8 TRCN0000107572 GCAGAACTAAGCAAGGATCTT pLKO.1 1385 CDS 100% 4.950 3.465 N NPAS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178864.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.