Transcript: Mouse NM_178888.4

Mus musculus GTPase activating RANGAP domain-like 3 (Garnl3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Garnl3 (99326)
Length:
3387
CDS:
116..3097

Additional Resources:

NCBI RefSeq record:
NM_178888.4
NBCI Gene record:
Garnl3 (99326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178888.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106231 GCGCCACATTGGAAACGATAT pLKO.1 934 CDS 100% 10.800 15.120 N Garnl3 n/a
2 TRCN0000106230 CCTATTGGCCATCCTTAGTTT pLKO.1 3107 3UTR 100% 5.625 7.875 N Garnl3 n/a
3 TRCN0000106233 CGTGCAATTCTTTGGCGGAAA pLKO.1 464 CDS 100% 4.050 5.670 N Garnl3 n/a
4 TRCN0000416837 GTGGTTGCAATTCGCAATAAA pLKO_005 1859 CDS 100% 15.000 12.000 N Garnl3 n/a
5 TRCN0000106234 GCAGCTATTGATGTTTATGAA pLKO.1 2159 CDS 100% 5.625 3.938 N Garnl3 n/a
6 TRCN0000106232 CCCGTGTTTGACAGAACTCTA pLKO.1 1610 CDS 100% 4.950 3.465 N Garnl3 n/a
7 TRCN0000048310 GCCATATTCCAAAGAGAACAA pLKO.1 895 CDS 100% 4.950 3.465 N GARNL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178888.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15192 pDONR223 82.6% 88% 34.2% None (many diffs) n/a
2 ccsbBroad304_15192 pLX_304 0% 88% 34.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV