Transcript: Mouse NM_178894.4

Mus musculus expressed sequence AA792892 (AA792892), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
AA792892 (100554)
Length:
1212
CDS:
137..973

Additional Resources:

NCBI RefSeq record:
NM_178894.4
NBCI Gene record:
AA792892 (100554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246842 ATGACTCCCTTCGAGACCTTC pLKO_005 413 CDS 100% 4.050 2.835 N AA792892 n/a
2 TRCN0000246845 CCATCACCCAATGCCTAATTT pLKO_005 435 CDS 100% 15.000 9.000 N AA792892 n/a
3 TRCN0000246843 AGGCTTGGAACACATCTTTAA pLKO_005 1010 3UTR 100% 13.200 7.920 N AA792892 n/a
4 TRCN0000248757 TCCCTGTGGGACCATTGATAA pLKO_005 309 CDS 100% 13.200 7.920 N AA792892 n/a
5 TRCN0000183792 CAGATAGCTGTCACAAATGTT pLKO.1 900 CDS 100% 5.625 3.375 N AA792892 n/a
6 TRCN0000183139 CCCTATACTTTGTTCTTGTTT pLKO.1 946 CDS 100% 5.625 3.375 N AA792892 n/a
7 TRCN0000216046 CTTATATGCTTTGGATCTTAT pLKO.1 532 CDS 100% 13.200 6.600 Y AA792892 n/a
8 TRCN0000246844 CTTATATGCTTTGGATCTTAT pLKO_005 532 CDS 100% 13.200 6.600 Y AA792892 n/a
9 TRCN0000376335 TGAAGGACTCCCAGATCAATG pLKO_005 621 CDS 100% 10.800 5.400 Y C87414 n/a
10 TRCN0000376272 TTATATGCTTTGGATCTTATG pLKO_005 533 CDS 100% 10.800 5.400 Y C87414 n/a
11 TRCN0000269611 CAAGATGAATGTGGAACAATA pLKO_005 754 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.