Transcript: Mouse NM_178897.4

Mus musculus tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) (Tyw1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tyw1 (100929)
Length:
4698
CDS:
24..1388

Additional Resources:

NCBI RefSeq record:
NM_178897.4
NBCI Gene record:
Tyw1 (100929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178897.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216449 GTGTTTCATCCAACCTATAAT pLKO.1 2507 3UTR 100% 15.000 21.000 N Tyw1 n/a
2 TRCN0000178467 GCGAAGGAAGAGCTATGATAA pLKO.1 1039 CDS 100% 13.200 18.480 N Tyw1 n/a
3 TRCN0000198977 GAGTGGTTCTGCAAGTGGTTA pLKO.1 444 CDS 100% 4.950 3.960 N Tyw1 n/a
4 TRCN0000178344 GCAGGTGGACAAAGGTATTTA pLKO.1 1132 CDS 100% 15.000 10.500 N Tyw1 n/a
5 TRCN0000178513 CCTACAGGATTTGGTTCTCTT pLKO.1 1249 CDS 100% 4.950 3.465 N Tyw1 n/a
6 TRCN0000178345 GATCCAGATGACAGTCTGATA pLKO.1 348 CDS 100% 4.950 3.465 N Tyw1 n/a
7 TRCN0000178153 GTGGATGAACAGGTTCTACAT pLKO.1 68 CDS 100% 4.950 3.465 N Tyw1 n/a
8 TRCN0000176877 GCCATTATTAATCTGAAGGAA pLKO.1 324 CDS 100% 3.000 2.100 N Tyw1 n/a
9 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 4581 3UTR 100% 2.640 1.320 Y Adsl n/a
10 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 4581 3UTR 100% 2.640 1.320 Y Adsl n/a
11 TRCN0000198922 GCTTCCCAAATGCTGGGATTA pLKO.1 2084 3UTR 100% 1.080 0.540 Y Tyw1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178897.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.