Transcript: Mouse NM_178908.3

Mus musculus family with sequence similarity 26, member E (Fam26e), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fam26e (103511)
Length:
1786
CDS:
83..1012

Additional Resources:

NCBI RefSeq record:
NM_178908.3
NBCI Gene record:
Fam26e (103511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125310 GTTTGTGAATCATCTACCATT pLKO.1 1005 CDS 100% 4.950 6.930 N Fam26e n/a
2 TRCN0000125312 GTGGTACACTCATTCGGAGTT pLKO.1 1043 3UTR 100% 4.050 5.670 N Fam26e n/a
3 TRCN0000440924 AGTGAGAGGAACCTCAAATGC pLKO_005 794 CDS 100% 4.950 3.465 N Fam26e n/a
4 TRCN0000125313 CCTGGAATGTGCTAACAAGTT pLKO.1 772 CDS 100% 4.950 3.465 N Fam26e n/a
5 TRCN0000125309 GCTCAGACTGATTGATGCTAA pLKO.1 1183 3UTR 100% 4.950 3.465 N Fam26e n/a
6 TRCN0000125311 TGGCTGCTGTATGAACCCAAA pLKO.1 316 CDS 100% 4.050 2.430 N Fam26e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.