Transcript: Mouse NM_180678.3

Mus musculus glycyl-tRNA synthetase (Gars), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gars (353172)
Length:
2390
CDS:
42..2231

Additional Resources:

NCBI RefSeq record:
NM_180678.3
NBCI Gene record:
Gars (353172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_180678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075748 GCTTATGACCATCGTGCTAAT pLKO.1 2244 3UTR 100% 10.800 15.120 N Gars n/a
2 TRCN0000324945 GCTTATGACCATCGTGCTAAT pLKO_005 2244 3UTR 100% 10.800 15.120 N Gars n/a
3 TRCN0000075752 GCATCACTATTGACTTTGATA pLKO.1 2017 CDS 100% 5.625 7.875 N Gars n/a
4 TRCN0000324947 GCATCACTATTGACTTTGATA pLKO_005 2017 CDS 100% 5.625 7.875 N Gars n/a
5 TRCN0000075751 GATACGTTGAAGAGGAGGTTT pLKO.1 387 CDS 100% 4.950 6.930 N Gars n/a
6 TRCN0000325022 GATACGTTGAAGAGGAGGTTT pLKO_005 387 CDS 100% 4.950 6.930 N Gars n/a
7 TRCN0000075750 GCAGAGATTGAGCACTTTGTA pLKO.1 1056 CDS 100% 5.625 3.938 N Gars n/a
8 TRCN0000353876 GCAGAGATTGAGCACTTTGTA pLKO_005 1056 CDS 100% 5.625 3.938 N Gars n/a
9 TRCN0000075749 GCCTGTGATGAGTGCTACATT pLKO.1 1572 CDS 100% 5.625 3.938 N Gars n/a
10 TRCN0000324946 GCCTGTGATGAGTGCTACATT pLKO_005 1572 CDS 100% 5.625 3.938 N Gars n/a
11 TRCN0000045793 GCTGTTGAACAGGGTGTGATT pLKO.1 1194 CDS 100% 4.950 3.465 N GARS1 n/a
12 TRCN0000291014 GCTGTTGAACAGGGTGTGATT pLKO_005 1194 CDS 100% 4.950 3.465 N GARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_180678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10837 pDONR223 100% 85.4% 89.3% None (many diffs) n/a
2 ccsbBroad304_10837 pLX_304 0% 85.4% 89.3% V5 (many diffs) n/a
Download CSV