Transcript: Mouse NM_181407.4

Mus musculus malic enzyme 3, NADP(+)-dependent, mitochondrial (Me3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Me3 (109264)
Length:
4370
CDS:
94..1908

Additional Resources:

NCBI RefSeq record:
NM_181407.4
NBCI Gene record:
Me3 (109264)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114873 CGGTGACAGATAAGTTCGGAA pLKO.1 890 CDS 100% 2.640 3.696 N Me3 n/a
2 TRCN0000114874 GTTCGGAATAAATTGCCTCAT pLKO.1 903 CDS 100% 4.050 3.240 N Me3 n/a
3 TRCN0000114875 CCAACAATGAGGAGCTTCTTA pLKO.1 788 CDS 100% 5.625 3.938 N Me3 n/a
4 TRCN0000114872 GCAGTCAAAGTCCTCGACTAT pLKO.1 1738 CDS 100% 4.950 3.465 N Me3 n/a
5 TRCN0000114871 CCCGTTAGATTTAATGTCTAA pLKO.1 2653 3UTR 100% 0.495 0.347 N Me3 n/a
6 TRCN0000064836 CTCCAGACTATGACTCCTTTA pLKO.1 1835 CDS 100% 10.800 7.560 N ME3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.