Transcript: Mouse NM_181418.3

Mus musculus USH1 protein network component harmonin binding protein 1 (Ushbp1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ushbp1 (234395)
Length:
3549
CDS:
165..2207

Additional Resources:

NCBI RefSeq record:
NM_181418.3
NBCI Gene record:
Ushbp1 (234395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181418.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181889 GCAGTATAGTGAGGACTGTGA pLKO.1 1169 CDS 100% 2.640 3.696 N Ushbp1 n/a
2 TRCN0000182040 CTATCCTTGAGCCCAGAAGAA pLKO.1 378 CDS 100% 4.950 3.465 N Ushbp1 n/a
3 TRCN0000177989 GATATCAGTACCCAGTGTGTA pLKO.1 467 CDS 100% 4.950 3.465 N Ushbp1 n/a
4 TRCN0000198495 GAGACTAAACCTGAGCTGCAT pLKO.1 279 CDS 100% 2.640 1.848 N Ushbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181418.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.