Transcript: Human NM_181461.4

Homo sapiens paired box 3 (PAX3), transcript variant PAX3G, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
PAX3 (5077)
Length:
3112
CDS:
384..1595

Additional Resources:

NCBI RefSeq record:
NM_181461.4
NBCI Gene record:
PAX3 (5077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181461.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015914 GCTGGGAAATCCGAGACAAAT pLKO.1 772 CDS 100% 13.200 9.240 N PAX3 n/a
2 TRCN0000015916 GAAAGCGAGAAGAAGGCCAAA pLKO.1 918 CDS 100% 4.050 2.835 N PAX3 n/a
3 TRCN0000015915 CCTGAGAAGTAAATTCGGGAA pLKO.1 854 CDS 100% 2.160 1.512 N PAX3 n/a
4 TRCN0000015917 CCGCCACAAGATCGTGGAGAT pLKO.1 548 CDS 100% 1.350 0.810 N PAX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181461.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06689 pDONR223 100% 49.9% 48.8% None (many diffs) n/a
2 ccsbBroad304_06689 pLX_304 0% 49.9% 48.8% V5 (many diffs) n/a
3 TRCN0000468147 TGGATAAGGCTGATTCTCCTTGGT pLX_317 61.4% 49.9% 48.8% V5 (many diffs) n/a
Download CSV