Transcript: Human NM_181486.3

Homo sapiens T-box transcription factor 5 (TBX5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
TBX5 (6910)
Length:
3714
CDS:
556..2112

Additional Resources:

NCBI RefSeq record:
NM_181486.3
NBCI Gene record:
TBX5 (6910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005072 GCCGACGATCACAGATACAAA pLKO.1 880 CDS 100% 5.625 7.875 N TBX5 n/a
2 TRCN0000005074 GCTGCACAGAATGTCAAGAAT pLKO.1 1284 CDS 100% 5.625 3.938 N TBX5 n/a
3 TRCN0000005073 CCTAGATTACACATCGTGAAA pLKO.1 1096 CDS 100% 4.950 3.465 N TBX5 n/a
4 TRCN0000005071 CCTATGCGATTATGTCTCTTT pLKO.1 3600 3UTR 100% 4.950 3.465 N TBX5 n/a
5 TRCN0000005075 CCAAGAGGAAAGAGGAAGAAT pLKO.1 1526 CDS 100% 5.625 3.375 N TBX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.