Transcript: Human NM_181505.4

Homo sapiens protein phosphatase 1 regulatory inhibitor subunit 1B (PPP1R1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PPP1R1B (84152)
Length:
1497
CDS:
232..738

Additional Resources:

NCBI RefSeq record:
NM_181505.4
NBCI Gene record:
PPP1R1B (84152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052878 CCCGTGCTGTAATAAATCTTT pLKO.1 1469 3UTR 100% 5.625 7.875 N PPP1R1B n/a
2 TRCN0000052879 CCTACACACCACCTTCGCTGA pLKO.1 341 CDS 100% 0.720 1.008 N PPP1R1B n/a
3 TRCN0000052880 TACACACCACCTTCGCTGAAA pLKO.1 343 CDS 100% 4.950 3.960 N PPP1R1B n/a
4 TRCN0000355617 CCTGCAGTCTATCAGCAATTT pLKO_005 390 CDS 100% 13.200 9.240 N PPP1R1B n/a
5 TRCN0000355618 TTCTCCATAGCCTCAACATTT pLKO_005 1237 3UTR 100% 13.200 9.240 N PPP1R1B n/a
6 TRCN0000378202 ACACACCACCTTCGCTGAAAG pLKO_005 344 CDS 100% 10.800 7.560 N PPP1R1B n/a
7 TRCN0000378408 TGGTCTGTGTTTGCTTGTTTG pLKO_005 876 3UTR 100% 10.800 7.560 N PPP1R1B n/a
8 TRCN0000052881 CTACACACCACCTTCGCTGAA pLKO.1 342 CDS 100% 4.050 2.835 N PPP1R1B n/a
9 TRCN0000052882 GGAAGACCCAGCACTAAGTGA pLKO.1 669 CDS 100% 3.000 2.100 N PPP1R1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04336 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04336 pLX_304 0% 100% 100% V5 n/a
Download CSV