Transcript: Mouse NM_181590.5

Mus musculus SHQ1 homolog (S. cerevisiae) (Shq1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Shq1 (72171)
Length:
3261
CDS:
97..1806

Additional Resources:

NCBI RefSeq record:
NM_181590.5
NBCI Gene record:
Shq1 (72171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181590.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215530 GAGTGAGGTTATCGATATTAA pLKO.1 597 CDS 100% 15.000 21.000 N Shq1 n/a
2 TRCN0000249246 TGAGTGAGGTTATCGATATTA pLKO_005 596 CDS 100% 15.000 21.000 N Shq1 n/a
3 TRCN0000249247 TCTACGCCAAGCCGTACTTTC pLKO_005 215 CDS 100% 10.800 15.120 N Shq1 n/a
4 TRCN0000192385 CGATCATTATCTAGCTGACTT pLKO.1 690 CDS 100% 4.950 6.930 N Shq1 n/a
5 TRCN0000190386 CCGATCATTATCTAGCTGACT pLKO.1 689 CDS 100% 2.640 3.696 N Shq1 n/a
6 TRCN0000249244 AGCCTACCGAGACACTATAAA pLKO_005 1128 CDS 100% 15.000 12.000 N Shq1 n/a
7 TRCN0000249245 CTATCCACTTTATCGTCATTT pLKO_005 1092 CDS 100% 13.200 10.560 N Shq1 n/a
8 TRCN0000249243 CTCAAGTGGTGCGCTCATTAC pLKO_005 1807 CDS 100% 10.800 8.640 N Shq1 n/a
9 TRCN0000190425 CCTATGAAGAGGTCTCAGAAA pLKO.1 500 CDS 100% 4.950 2.970 N Shq1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181590.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.