Transcript: Mouse NM_181682.2

Mus musculus desmoglein 1 beta (Dsg1b), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dsg1b (225256)
Length:
5952
CDS:
207..3389

Additional Resources:

NCBI RefSeq record:
NM_181682.2
NBCI Gene record:
Dsg1b (225256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094310 GTAGTGGATATCCACCTATAT pLKO.1 2650 CDS 100% 13.200 18.480 N Dsg1b n/a
2 TRCN0000094312 GTAATCGTGACCCAGTGACTA pLKO.1 1714 CDS 100% 4.950 3.960 N Dsg1b n/a
3 TRCN0000094309 AGTCATCTTATGACATCGAAA pLKO.1 1018 CDS 100% 4.950 3.465 N Dsg1b n/a
4 TRCN0000094313 CACAGAAGACAACGTTCACTT pLKO.1 1880 CDS 100% 4.950 3.465 N Dsg1b n/a
5 TRCN0000219612 AGATTCAGGCTAAGGTTAATA pLKO.1 4136 3UTR 100% 15.000 7.500 Y Dsg1a n/a
6 TRCN0000203451 CCTGAGATATGCCAAGAATAT pLKO.1 2265 CDS 100% 13.200 6.600 Y Dsg1a n/a
7 TRCN0000203501 CCATGAAGAATCTACAGCTTA pLKO.1 1228 CDS 100% 4.950 2.475 Y Dsg1a n/a
8 TRCN0000094311 GCCAAATAACTTGAACTCAAT pLKO.1 764 CDS 100% 4.950 2.475 Y Dsg1b n/a
9 TRCN0000185974 GCCAAATAACTTGAACTCAAT pLKO.1 764 CDS 100% 4.950 2.475 Y Dsg1a n/a
10 TRCN0000187469 GCCACCTTATGGAATCTTCAT pLKO.1 488 CDS 100% 4.950 2.475 Y Dsg1a n/a
11 TRCN0000053810 CGAAGTCGAATCACAAAGTAT pLKO.1 3345 CDS 100% 5.625 2.813 Y DSG1 n/a
12 TRCN0000187106 CGACCACAGTAATTTCTGAAA pLKO.1 2686 CDS 100% 4.950 2.475 Y Dsg1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.