Transcript: Human NM_181706.5

Homo sapiens DnaJ heat shock protein family (Hsp40) member C24 (DNAJC24), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DNAJC24 (120526)
Length:
2970
CDS:
87..536

Additional Resources:

NCBI RefSeq record:
NM_181706.5
NBCI Gene record:
DNAJC24 (120526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181706.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364968 TATTTGTCAGCCCGATTATTT pLKO_005 622 3UTR 100% 15.000 21.000 N DNAJC24 n/a
2 TRCN0000145424 GTTAGCCTGATTTCTTGTGAT pLKO.1 477 CDS 100% 4.950 6.930 N DNAJC24 n/a
3 TRCN0000364969 GTGATACATGTTCACTAATTA pLKO_005 493 CDS 100% 15.000 12.000 N DNAJC24 n/a
4 TRCN0000144722 GATCTAAGAAATGTAGGACCA pLKO.1 342 CDS 100% 2.160 1.728 N DNAJC24 n/a
5 TRCN0000369959 CAGACCCATCTGCAAATATAT pLKO_005 139 CDS 100% 15.000 10.500 N DNAJC24 n/a
6 TRCN0000364970 ACCAGTAGATGCTCAAGTATA pLKO_005 359 CDS 100% 13.200 9.240 N DNAJC24 n/a
7 TRCN0000141038 CGGAAGAAGTTAGCCTGATTT pLKO.1 469 CDS 100% 13.200 9.240 N DNAJC24 n/a
8 TRCN0000369987 TGGGTAACAGTATCATCATAT pLKO_005 859 3UTR 100% 13.200 9.240 N DNAJC24 n/a
9 TRCN0000364971 TGTACAGAAGTTCATCGAAAT pLKO_005 251 CDS 100% 10.800 7.560 N DNAJC24 n/a
10 TRCN0000122075 CGTTTCTAGTTGCTAAAGTTA pLKO.1 917 3UTR 100% 5.625 3.938 N DNAJC24 n/a
11 TRCN0000377361 TTGGAATGAAGGTGATCACTC pLKO_005 395 CDS 100% 4.050 2.835 N DNAJC24 n/a
12 TRCN0000145242 GAAATGTCTTGGAATGAAGGT pLKO.1 387 CDS 100% 2.640 1.848 N DNAJC24 n/a
13 TRCN0000141500 CAAAGTACAGATGTACCAGCA pLKO.1 213 CDS 100% 2.160 1.512 N DNAJC24 n/a
14 TRCN0000140463 GTTTCCAAGGATGAAGCGGAA pLKO.1 453 CDS 100% 2.160 1.512 N DNAJC24 n/a
15 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 1409 3UTR 100% 10.800 5.400 Y MRPS16 n/a
16 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 1409 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181706.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14363 pDONR223 100% 99.3% 99.3% None 1_3delATG n/a
2 ccsbBroad304_14363 pLX_304 0% 99.3% 99.3% V5 (not translated due to frame shift) 1_3delATG n/a
Download CSV