Transcript: Mouse NM_181796.2

Mus musculus glutathione S-transferase, pi 2 (Gstp2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gstp2 (14869)
Length:
785
CDS:
57..689

Additional Resources:

NCBI RefSeq record:
NM_181796.2
NBCI Gene record:
Gstp2 (14869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432024 CAGATCTCCTTTGCCGATTAC pLKO_005 498 CDS 100% 10.800 5.400 Y Gstp2 n/a
2 TRCN0000103232 CCAGATCTCCTTTGCCGATTA pLKO.1 497 CDS 100% 10.800 5.400 Y Gstp1 n/a
3 TRCN0000325654 CCAGATCTCCTTTGCCGATTA pLKO_005 497 CDS 100% 10.800 5.400 Y Gstp1 n/a
4 TRCN0000425408 CCCAGGTGGATATGGTGAATG pLKO_005 319 CDS 100% 10.800 5.400 Y Gstp2 n/a
5 TRCN0000423541 AGGAGGAGGTGGTTACCATAG pLKO_005 145 CDS 100% 6.000 3.000 Y Gstp2 n/a
6 TRCN0000011905 CCTCACCCTTTACCAATCTAA pLKO.1 236 CDS 100% 5.625 2.813 Y Gstp2 n/a
7 TRCN0000011904 CAGAAACTATGAGAATGGTAA pLKO.1 383 CDS 100% 4.950 2.475 Y Gstp2 n/a
8 TRCN0000011903 CGGCAAATATGGCACCATGAT pLKO.1 359 CDS 100% 4.950 2.475 Y Gstp2 n/a
9 TRCN0000011907 GATCTACAGAAACTATGAGAA pLKO.1 377 CDS 100% 4.950 2.475 Y Gstp2 n/a
10 TRCN0000421884 GCTCAAGCCCACTTGTCTGTA pLKO_005 185 CDS 100% 4.950 2.475 Y Gstp2 n/a
11 TRCN0000011906 TGGCACCATGATCTACAGAAA pLKO.1 368 CDS 100% 4.950 2.475 Y Gstp2 n/a
12 TRCN0000103233 CCTTTACCAATCTAATGCCAT pLKO.1 242 CDS 100% 2.640 1.320 Y Gstp1 n/a
13 TRCN0000325653 CCTTTACCAATCTAATGCCAT pLKO_005 242 CDS 100% 2.640 1.320 Y Gstp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.