Transcript: Human NM_181839.3

Homo sapiens cAMP-dependent protein kinase inhibitor alpha (PKIA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PKIA (5569)
Length:
3833
CDS:
157..387

Additional Resources:

NCBI RefSeq record:
NM_181839.3
NBCI Gene record:
PKIA (5569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181839.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378126 GCTTGTGTTTGGGCGTCATTT pLKO_005 603 3UTR 100% 13.200 18.480 N PKIA n/a
2 TRCN0000355855 CTAATTGCGAAGGGTTGATTG pLKO_005 743 3UTR 100% 10.800 15.120 N PKIA n/a
3 TRCN0000321060 AGTGGCAACAGCAATGAATTA pLKO_005 250 CDS 100% 13.200 9.240 N Pkia n/a
4 TRCN0000355921 GAAATTAGCAGGTCTTGATAT pLKO_005 276 CDS 100% 13.200 9.240 N PKIA n/a
5 TRCN0000421866 GCAATGAATTAGCCTTGAAAT pLKO_005 260 CDS 100% 13.200 9.240 N PKIA n/a
6 TRCN0000427329 ACGAAGTTCTACAGAACAAAG pLKO_005 327 CDS 100% 10.800 7.560 N PKIA n/a
7 TRCN0000415787 AGAAATGCAATACATGATATC pLKO_005 214 CDS 100% 10.800 7.560 N PKIA n/a
8 TRCN0000002808 CAAGTGGCAACAGCAATGAAT pLKO.1 248 CDS 100% 5.625 3.938 N PKIA n/a
9 TRCN0000002809 GCTCCGACCTAGATGATGATT pLKO.1 674 3UTR 100% 5.625 3.938 N PKIA n/a
10 TRCN0000002807 TGAAATTAGCAGGTCTTGATA pLKO.1 275 CDS 100% 5.625 3.938 N PKIA n/a
11 TRCN0000002805 GAAGAAGATGCACAACGAAGT pLKO.1 313 CDS 100% 4.050 2.835 N PKIA n/a
12 TRCN0000012467 GAACAGGTAGAAGAAATGCAA pLKO.1 203 CDS 100% 3.000 2.100 N Pkia n/a
13 TRCN0000320986 GAACAGGTAGAAGAAATGCAA pLKO_005 203 CDS 100% 3.000 2.100 N Pkia n/a
14 TRCN0000002806 GCAAGTGGCAACAGCAATGAA pLKO.1 247 CDS 100% 5.625 3.375 N PKIA n/a
15 TRCN0000012465 GCAATACATGATATCCTGGTT pLKO.1 220 CDS 100% 2.640 1.584 N Pkia n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181839.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.