Transcript: Human NM_181840.1

Homo sapiens potassium two pore domain channel subfamily K member 18 (KCNK18), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
KCNK18 (338567)
Length:
1155
CDS:
1..1155

Additional Resources:

NCBI RefSeq record:
NM_181840.1
NBCI Gene record:
KCNK18 (338567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150115 CATCTTATAATCGGTTCCGAA pLKO.1 482 CDS 100% 2.640 3.696 N KCNK18 n/a
2 TRCN0000148443 CCCTAACTTCTTCCTGTTCTT pLKO.1 999 CDS 100% 4.950 3.465 N KCNK18 n/a
3 TRCN0000149860 GAGCTGTTTGAGAGATCTCAT pLKO.1 676 CDS 100% 4.950 3.465 N KCNK18 n/a
4 TRCN0000148013 GCAACCATCTTATCTACATCT pLKO.1 466 CDS 100% 4.950 3.465 N KCNK18 n/a
5 TRCN0000148488 CAGATCATCATCAGTGCTGAA pLKO.1 601 CDS 100% 4.050 2.835 N KCNK18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.