Transcript: Human NM_182540.6

Homo sapiens integrator complex subunit 6 like (INTS6L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
INTS6L (203522)
Length:
3820
CDS:
334..2919

Additional Resources:

NCBI RefSeq record:
NM_182540.6
NBCI Gene record:
INTS6L (203522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182540.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111189 CGTTGGGATCAAAGGTTATTT pLKO.1 820 CDS 100% 15.000 21.000 N Ints6l n/a
2 TRCN0000152042 CGTTGGGATCAAAGGTTATTT pLKO.1 820 CDS 100% 15.000 21.000 N INTS6L n/a
3 TRCN0000365037 GTTGGGATCAAAGGTTATTTG pLKO_005 821 CDS 100% 13.200 18.480 N INTS6L n/a
4 TRCN0000377439 TATGTACGACCTAACTCTAAA pLKO_005 1150 CDS 100% 13.200 18.480 N INTS6L n/a
5 TRCN0000153619 CGCTGTGGAGTTATTCTTGAA pLKO.1 423 CDS 100% 4.950 6.930 N INTS6L n/a
6 TRCN0000152575 GCAACATTCATGAGCGAACTA pLKO.1 544 CDS 100% 4.950 6.930 N INTS6L n/a
7 TRCN0000370076 GGATATCCATTTGGTTATTTA pLKO_005 1429 CDS 100% 15.000 10.500 N INTS6L n/a
8 TRCN0000365084 TGCCTCCATACTACCTATTAA pLKO_005 1601 CDS 100% 15.000 10.500 N INTS6L n/a
9 TRCN0000376543 TGCAATATTCAGGATAGTTTG pLKO_005 3397 3UTR 100% 10.800 7.560 N INTS6L n/a
10 TRCN0000370037 TTGCACAAATGGGTAACTATC pLKO_005 1985 CDS 100% 10.800 7.560 N INTS6L n/a
11 TRCN0000150967 GCCCTTAACTCAGTATATCTT pLKO.1 1341 CDS 100% 5.625 3.938 N INTS6L n/a
12 TRCN0000153839 CCATCACAGATGGAAACAAGT pLKO.1 713 CDS 100% 4.950 3.465 N INTS6L n/a
13 TRCN0000158175 CCTTCGCCCTTAACTCAGTAT pLKO.1 1336 CDS 100% 4.950 3.465 N INTS6L n/a
14 TRCN0000157539 GTGAGGTTCTCCTGTGTAGAT pLKO.1 1264 CDS 100% 4.950 3.465 N INTS6L n/a
15 TRCN0000156707 CCACGAACATCTCATCCTGTT pLKO.1 1243 CDS 100% 4.050 2.835 N INTS6L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182540.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.