Transcript: Human NM_182557.3

Homo sapiens BCL9 like (BCL9L), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
BCL9L (283149)
Length:
9643
CDS:
604..5103

Additional Resources:

NCBI RefSeq record:
NM_182557.3
NBCI Gene record:
BCL9L (283149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429549 GCAATGTTGCAAATACGATAA pLKO_005 5130 3UTR 100% 10.800 15.120 N BCL9L n/a
2 TRCN0000033509 GCCACCCACAATTGTAATGTA pLKO.1 1126 CDS 100% 5.625 3.938 N BCL9L n/a
3 TRCN0000033512 CATGGGCAATACCCAAGACAT pLKO.1 3189 CDS 100% 4.950 3.465 N BCL9L n/a
4 TRCN0000033510 GCCTAGCAACTCAAGTCTGAA pLKO.1 867 CDS 100% 4.950 3.465 N BCL9L n/a
5 TRCN0000033511 GCATCTCATGAACCTGCAGAA pLKO.1 4674 CDS 100% 4.050 2.835 N BCL9L n/a
6 TRCN0000033513 CCCAGCAGAATTTCATGCTGA pLKO.1 4889 CDS 100% 0.264 0.185 N BCL9L n/a
7 TRCN0000198681 CTCATGAACCTGCAGAACATG pLKO.1 4678 CDS 100% 4.950 2.970 N Bcl9l n/a
8 TRCN0000277574 CTCATGAACCTGCAGAACATG pLKO_005 4678 CDS 100% 4.950 2.970 N Bcl9l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.