Transcript: Human NM_182569.4

Homo sapiens glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GDPD1 (284161)
Length:
3241
CDS:
100..1044

Additional Resources:

NCBI RefSeq record:
NM_182569.4
NBCI Gene record:
GDPD1 (284161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143449 GCTAGAATTGGACTGCCATAT pLKO.1 309 CDS 100% 10.800 15.120 N GDPD1 n/a
2 TRCN0000143254 GCGGTATAATCGAGAACACTT pLKO.1 603 CDS 100% 4.950 6.930 N GDPD1 n/a
3 TRCN0000144449 CGAGGCATTCAAGTGTATATT pLKO.1 910 CDS 100% 15.000 10.500 N GDPD1 n/a
4 TRCN0000144619 GAAATCCCAATGCCTTCTATT pLKO.1 781 CDS 100% 13.200 9.240 N GDPD1 n/a
5 TRCN0000121818 GCAGTGTTCTATCATAAGTAA pLKO.1 1444 3UTR 100% 5.625 3.938 N GDPD1 n/a
6 TRCN0000145458 GATGATGCAGTGTTCTATCAT pLKO.1 1438 3UTR 100% 0.563 0.394 N GDPD1 n/a
7 TRCN0000139251 CCAGAGAAAGAAGCAGCGATT pLKO.1 192 CDS 100% 4.050 2.430 N GDPD1 n/a
8 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 1560 3UTR 100% 4.050 2.025 Y GDPD1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1522 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05376 pDONR223 100% 90.9% 85.2% None (many diffs) n/a
2 ccsbBroad304_05376 pLX_304 0% 90.9% 85.2% V5 (many diffs) n/a
Download CSV