Transcript: Human NM_182744.3

Homo sapiens NBL1, DAN family BMP antagonist (NBL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NBL1 (4681)
Length:
2079
CDS:
84..734

Additional Resources:

NCBI RefSeq record:
NM_182744.3
NBCI Gene record:
NBL1 (4681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182744.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042413 GCCAAGCTGCACAATTTAATA pLKO.1 907 3UTR 100% 15.000 7.500 Y Nbl1 n/a
2 TRCN0000038034 GCTGGCACTGTTCCCAGATAA pLKO.1 260 CDS 100% 13.200 6.600 Y NBL1 n/a
3 TRCN0000373083 AGAAAGACCACTGGCAGAAAC pLKO_005 1180 3UTR 100% 10.800 5.400 Y NBL1 n/a
4 TRCN0000378850 CCATCCAAGATGGCATGAATC pLKO_005 1065 3UTR 100% 10.800 5.400 Y NBL1 n/a
5 TRCN0000038038 TGAGGCCAAGTCCATCCAGAA pLKO.1 335 CDS 100% 4.050 2.025 Y NBL1 n/a
6 TRCN0000038036 CAAGAACATCACCCAGATCGT pLKO.1 299 CDS 100% 2.640 1.320 Y NBL1 n/a
7 TRCN0000038037 GTGGAGAAGATCCTGCACTGT pLKO.1 522 CDS 100% 2.640 1.320 Y NBL1 n/a
8 TRCN0000042416 GCCCAGTCCATGTGGGAGATT pLKO.1 450 CDS 100% 1.650 0.825 Y Nbl1 n/a
9 TRCN0000038035 CAGTCCACAGAGTCCCTGGTT pLKO.1 408 CDS 100% 0.880 0.440 Y NBL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182744.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.