Transcript: Human NM_182943.3

Homo sapiens procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 (PLOD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PLOD2 (5352)
Length:
3749
CDS:
196..2472

Additional Resources:

NCBI RefSeq record:
NM_182943.3
NBCI Gene record:
PLOD2 (5352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064811 GCTCCTCTTGTAACTCGTCAT pLKO.1 1438 CDS 100% 4.050 5.670 N PLOD2 n/a
2 TRCN0000064809 CCAGTTACACTGAAGGTCTTT pLKO.1 2152 CDS 100% 4.950 3.960 N PLOD2 n/a
3 TRCN0000064810 CGTATAGTTCAACAATGGAAT pLKO.1 727 CDS 100% 4.950 3.465 N PLOD2 n/a
4 TRCN0000064812 CGATTTATGCAGTCAGCCAAA pLKO.1 355 CDS 100% 4.050 2.835 N PLOD2 n/a
5 TRCN0000064808 CCACCAAGATTCTCCTGAATT pLKO.1 965 CDS 100% 0.000 0.000 N PLOD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.