Transcript: Human NM_182971.3

Homo sapiens cytochrome c oxidase subunit 8C (COX8C), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
COX8C (341947)
Length:
542
CDS:
88..306

Additional Resources:

NCBI RefSeq record:
NM_182971.3
NBCI Gene record:
COX8C (341947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046331 GCGGAAATGGCTGTTGGACTT pLKO.1 211 CDS 100% 4.050 2.835 N COX8C n/a
2 TRCN0000046328 GCTGTTGGACTTGTGGTGTTT pLKO.1 220 CDS 100% 4.950 2.475 Y COX8C n/a
3 TRCN0000046332 GCTAGGCAACCTGAAGCAGTT pLKO.1 273 CDS 100% 4.050 2.025 Y COX8C n/a
4 TRCN0000046330 ACGACCTTCTTAACACCAGCT pLKO.1 244 CDS 100% 2.160 1.080 Y COX8C n/a
5 TRCN0000046329 GCAACCTGAAGCAGTTCAGAA pLKO.1 278 CDS 100% 0.495 0.248 Y COX8C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14479 pDONR223 94.9% 100% 100% None n/a
2 ccsbBroad304_14479 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478534 GTCAAAAACACACCCTACCTAACG pLX_317 100% 100% 100% V5 n/a
Download CSV