Transcript: Mouse NM_183086.2

Mus musculus mitochondrial ribosomal protein S10 (Mrps10), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mrps10 (64657)
Length:
1125
CDS:
234..716

Additional Resources:

NCBI RefSeq record:
NM_183086.2
NBCI Gene record:
Mrps10 (64657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437241 GATACAGCAGTTGCCAGAACA pLKO_005 638 CDS 100% 4.950 6.930 N Mrps10 n/a
2 TRCN0000099443 CCTACGATAACCACTTCCGAT pLKO.1 291 CDS 100% 2.640 3.696 N Mrps10 n/a
3 TRCN0000099442 CCTGGAGTATATCCAGCGAAA pLKO.1 578 CDS 100% 0.405 0.567 N Mrps10 n/a
4 TRCN0000099444 CTACAGATGTTTGGAGTTAAA pLKO.1 527 CDS 100% 13.200 9.240 N Mrps10 n/a
5 TRCN0000437347 AGGATGCTTGTGTCCCGATAT pLKO_005 882 3UTR 100% 10.800 7.560 N Mrps10 n/a
6 TRCN0000437123 AGCGCTTCACTCTTCTCAAGT pLKO_005 457 CDS 100% 4.950 3.465 N Mrps10 n/a
7 TRCN0000413740 GAAACACAGAGTCCAGTATGA pLKO_005 494 CDS 100% 4.950 3.465 N Mrps10 n/a
8 TRCN0000099441 GCTGCTAAAGAACTTGGCATT pLKO.1 402 CDS 100% 4.050 2.835 N Mrps10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.