Transcript: Mouse NM_183175.4

Mus musculus C1q and tumor necrosis factor related protein 9 (C1qtnf9), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
C1qtnf9 (239126)
Length:
1903
CDS:
57..1058

Additional Resources:

NCBI RefSeq record:
NM_183175.4
NBCI Gene record:
C1qtnf9 (239126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119463 GAGAGGTTCAATGGCTTATTT pLKO.1 981 CDS 100% 15.000 21.000 N C1qtnf9 n/a
2 TRCN0000425774 GGACTCACGGTGATCAGTAAG pLKO_005 675 CDS 100% 10.800 15.120 N C1qtnf9 n/a
3 TRCN0000119465 CCGAAGGACTAATGGGCAGTA pLKO.1 460 CDS 100% 4.050 5.670 N C1qtnf9 n/a
4 TRCN0000424886 TGCATGCACGAGAAGTGTATT pLKO_005 89 CDS 100% 13.200 10.560 N C1qtnf9 n/a
5 TRCN0000119462 CCGTCATTTGAACACATGAAT pLKO.1 1218 3UTR 100% 5.625 4.500 N C1qtnf9 n/a
6 TRCN0000119464 GATCCTATACAATGAACTGAA pLKO.1 731 CDS 100% 4.950 3.465 N C1qtnf9 n/a
7 TRCN0000119466 CCCTGGGAATCCAGGTCACAA pLKO.1 146 CDS 100% 0.165 0.116 N C1qtnf9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.