Transcript: Mouse NM_183289.3

Mus musculus transcription elongation regulator 1-like (Tcerg1l), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tcerg1l (70571)
Length:
2569
CDS:
78..1850

Additional Resources:

NCBI RefSeq record:
NM_183289.3
NBCI Gene record:
Tcerg1l (70571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244282 AGATAAGAGGATGCCTAATTA pLKO_005 533 CDS 100% 15.000 21.000 N Tcerg1l n/a
2 TRCN0000244362 CCATGAGATGTCGAGTCTTTA pLKO_005 2034 3UTR 100% 13.200 18.480 N Tcerg1l n/a
3 TRCN0000086539 CCCGGAGGAATCGGTACTCTT pLKO.1 602 CDS 100% 1.650 2.310 N Tcerg1l n/a
4 TRCN0000244361 TATCGCCCAGGACCACATTTA pLKO_005 1684 CDS 100% 13.200 9.240 N Tcerg1l n/a
5 TRCN0000244281 GTGGCTGTTTGGTGGTCATTC pLKO_005 410 CDS 100% 10.800 7.560 N Tcerg1l n/a
6 TRCN0000244360 TTGGGAGAAAGAATTGCATAA pLKO_005 1502 CDS 100% 10.800 7.560 N Tcerg1l n/a
7 TRCN0000086542 GTGGTTGTCATGACAGTCTTA pLKO.1 739 CDS 100% 4.950 3.465 N Tcerg1l n/a
8 TRCN0000086540 ACTGTGGTATTAGCAGCTCAA pLKO.1 708 CDS 100% 4.050 2.835 N Tcerg1l n/a
9 TRCN0000086541 GCCGTGCCACTTCCTGACATT pLKO.1 878 CDS 100% 1.650 1.155 N Tcerg1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.