Transcript: Mouse NM_194060.1

Mus musculus forkhead box O6 (Foxo6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Foxo6 (329934)
Length:
2528
CDS:
10..1689

Additional Resources:

NCBI RefSeq record:
NM_194060.1
NBCI Gene record:
Foxo6 (329934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_194060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087773 CACCAATCTTAGTCATCCATT pLKO.1 2150 3UTR 100% 4.950 6.930 N Foxo6 n/a
2 TRCN0000087776 TGACGAAATGGACTTCAACTT pLKO.1 1593 CDS 100% 4.950 3.960 N Foxo6 n/a
3 TRCN0000087774 CAGTGACGAAATGGACTTCAA pLKO.1 1590 CDS 100% 4.950 3.465 N Foxo6 n/a
4 TRCN0000087777 CGTCGAGTCCATCATCCTCAA pLKO.1 1557 CDS 100% 4.050 2.835 N Foxo6 n/a
5 TRCN0000087775 CCTCGCCACTCATGTACCCAA pLKO.1 830 CDS 100% 0.880 0.616 N Foxo6 n/a
6 TRCN0000020707 CGTGCCCTACTTCAAGGATAA pLKO.1 372 CDS 100% 10.800 5.400 Y LOC391030 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.