Transcript: Human NM_194291.2

Homo sapiens transmembrane protein 65 (TMEM65), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
TMEM65 (157378)
Length:
4318
CDS:
543..1265

Additional Resources:

NCBI RefSeq record:
NM_194291.2
NBCI Gene record:
TMEM65 (157378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236145 CTGCACCGCTTCGAGTCTATT pLKO_005 813 CDS 100% 13.200 18.480 N TMEM65 n/a
2 TRCN0000236146 TTGTTGCTGGAACCCATATTG pLKO_005 952 CDS 100% 13.200 18.480 N TMEM65 n/a
3 TRCN0000134238 GTATTCATCCACAATGCGATA pLKO.1 891 CDS 100% 4.050 5.670 N TMEM65 n/a
4 TRCN0000137066 CCGTGTATACTAACAAGCGTA pLKO.1 1926 3UTR 100% 2.640 3.696 N TMEM65 n/a
5 TRCN0000236147 TACTTGTAACAGCGTAATTAA pLKO_005 2625 3UTR 100% 15.000 12.000 N TMEM65 n/a
6 TRCN0000236148 TCCAGGTTAGGCCTGTCAATT pLKO_005 1086 CDS 100% 13.200 9.240 N TMEM65 n/a
7 TRCN0000257233 CATGTGGCAAACACGTCTTAG pLKO_005 1133 CDS 100% 10.800 7.560 N TMEM65 n/a
8 TRCN0000134922 CACAATGCGATACCTTTCATA pLKO.1 900 CDS 100% 5.625 3.938 N TMEM65 n/a
9 TRCN0000138197 CCAGGACAGCTGAGATATGTA pLKO.1 873 CDS 100% 5.625 3.938 N TMEM65 n/a
10 TRCN0000138176 GCCTGTCAATTCCTGATCTCA pLKO.1 1096 CDS 100% 3.000 2.100 N TMEM65 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13301 pDONR223 100% 74.1% 74.1% None 1_186del n/a
2 ccsbBroad304_13301 pLX_304 0% 74.1% 74.1% V5 1_186del n/a
Download CSV