Transcript: Human NM_194318.4

Homo sapiens beta 3-glucosyltransferase (B3GLCT), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
B3GLCT (145173)
Length:
4215
CDS:
111..1607

Additional Resources:

NCBI RefSeq record:
NM_194318.4
NBCI Gene record:
B3GLCT (145173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194318.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427031 CTTAAGTATTCCACTTGTAAA pLKO_005 683 CDS 100% 13.200 18.480 N B3GLCT n/a
2 TRCN0000425132 GACTGTCTACAGTTCTATTTG pLKO_005 1991 3UTR 100% 13.200 18.480 N B3GLCT n/a
3 TRCN0000420314 ACTTCCGTTGTTACCGCATTT pLKO_005 440 CDS 100% 10.800 15.120 N B3GLCT n/a
4 TRCN0000035020 CGCCAGTAAATGTCGATGCTA pLKO.1 1331 CDS 100% 3.000 4.200 N B3GLCT n/a
5 TRCN0000424980 CCGACTTTACAATAGATTTAA pLKO_005 742 CDS 100% 15.000 12.000 N B3GLCT n/a
6 TRCN0000035019 CCAGTGAAGAAGAAGGATATT pLKO.1 897 CDS 100% 13.200 9.240 N B3GLCT n/a
7 TRCN0000414299 TTCTACTGTGCTACCACATTC pLKO_005 849 CDS 100% 10.800 7.560 N B3GLCT n/a
8 TRCN0000035022 CCAGAGTCAAAGTAATTCTTT pLKO.1 296 CDS 100% 5.625 3.938 N B3GLCT n/a
9 TRCN0000035021 GCCAGGCAAGTCTCATTGAAT pLKO.1 988 CDS 100% 5.625 3.938 N B3GLCT n/a
10 TRCN0000035023 GCATGGTTAGTCATTGTGGAT pLKO.1 1137 CDS 100% 2.640 1.848 N B3GLCT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194318.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.