Transcript: Mouse NM_194350.1

Mus musculus v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) (Mafa), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mafa (378435)
Length:
1080
CDS:
1..1080

Additional Resources:

NCBI RefSeq record:
NM_194350.1
NBCI Gene record:
Mafa (378435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_194350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086313 CGCGCAGTCGTGCCGCTTCAA pLKO.1 819 CDS 100% 0.000 0.000 N Mafa n/a
2 TRCN0000086315 CAACGACTTCGACCTGATGAA pLKO.1 63 CDS 100% 4.950 3.465 N Mafa n/a
3 TRCN0000016287 TCAACGACTTCGACCTGATGA pLKO.1 62 CDS 100% 4.950 3.465 N MAFA n/a
4 TRCN0000016283 CCTGATGAAGTTCGAGGTGAA pLKO.1 75 CDS 100% 4.050 2.835 N MAFA n/a
5 TRCN0000086317 CGACGACCAGCTGGTATCCAT pLKO.1 702 CDS 100% 1.000 0.700 N Mafa n/a
6 TRCN0000086316 GAGGAGGTCATCCGACTGAAA pLKO.1 766 CDS 100% 4.950 2.970 N Mafa n/a
7 TRCN0000086314 GCTGGAGGATCTGTACTGGAT pLKO.1 330 CDS 100% 2.640 1.584 N Mafa n/a
8 TRCN0000000256 ACAAGGAGAAATACGAGAAGT pLKO.1 947 CDS 100% 4.950 2.475 Y MAF n/a
9 TRCN0000000255 CAAGGAGAAATACGAGAAGTT pLKO.1 948 CDS 100% 4.950 2.475 Y MAF n/a
10 TRCN0000193799 CAAGGAGAAATACGAGAAGCT pLKO.1 948 CDS 100% 2.640 1.320 Y Maf n/a
11 TRCN0000423501 CAAGGAGAAATACGAGAAGCT pLKO_005 948 CDS 100% 2.640 1.320 Y MAFA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.