Transcript: Mouse NM_198019.2

Mus musculus centrosomal protein 78 (Cep78), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cep78 (208518)
Length:
2576
CDS:
110..2482

Additional Resources:

NCBI RefSeq record:
NM_198019.2
NBCI Gene record:
Cep78 (208518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219598 ACAGACTGCCACCGGACAAAT pLKO.1 1885 CDS 100% 13.200 18.480 N Cep78 n/a
2 TRCN0000200451 GCCTTCGAGTAATGGGAGAAA pLKO.1 1210 CDS 100% 4.950 6.930 N Cep78 n/a
3 TRCN0000200384 GCTGGCATAGATCAGTCAGAT pLKO.1 1772 CDS 100% 4.950 3.960 N Cep78 n/a
4 TRCN0000178547 GTGCTGATACACACCGAATTT pLKO.1 378 CDS 100% 13.200 9.240 N Cep78 n/a
5 TRCN0000197740 GTCTCATCTAAGACTATCAAA pLKO.1 2366 CDS 100% 5.625 3.938 N Cep78 n/a
6 TRCN0000200172 CTGGAGCTAAATGGGCTGATT pLKO.1 497 CDS 100% 4.950 3.465 N Cep78 n/a
7 TRCN0000177187 GTGATACTCTTGGATCTGATT pLKO.1 2418 CDS 100% 4.950 3.465 N Cep78 n/a
8 TRCN0000198164 CATCATCAAAGGAACCGTCTA pLKO.1 1101 CDS 100% 4.050 2.835 N Cep78 n/a
9 TRCN0000197530 CTGCTTAATGAGCCAATTAAA pLKO.1 2291 CDS 100% 1.500 1.050 N Cep78 n/a
10 TRCN0000176854 GCAACCATTAGAATTGGTTTA pLKO.1 1178 CDS 100% 1.080 0.756 N Cep78 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.