Transcript: Mouse NM_198023.2

Mus musculus REST corepressor 1 (Rcor1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rcor1 (217864)
Length:
2725
CDS:
103..1251

Additional Resources:

NCBI RefSeq record:
NM_198023.2
NBCI Gene record:
Rcor1 (217864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071368 CGCCGCTTCAACATAGATGAA pLKO.1 1075 CDS 100% 4.950 6.930 N Rcor1 n/a
2 TRCN0000301882 CGCCGCTTCAACATAGATGAA pLKO_005 1075 CDS 100% 4.950 6.930 N Rcor1 n/a
3 TRCN0000071371 GTCTTATTTGAGCAAGCCTTT pLKO.1 391 CDS 100% 4.050 3.240 N Rcor1 n/a
4 TRCN0000147902 GTCTTATTTGAGCAAGCCTTT pLKO.1 391 CDS 100% 4.050 3.240 N RCOR1 n/a
5 TRCN0000301950 GTCTTATTTGAGCAAGCCTTT pLKO_005 391 CDS 100% 4.050 3.240 N Rcor1 n/a
6 TRCN0000071370 GAAGAAACAAACGGCAGTAAT pLKO.1 583 CDS 100% 13.200 9.240 N Rcor1 n/a
7 TRCN0000331774 GAAGAAACAAACGGCAGTAAT pLKO_005 583 CDS 100% 13.200 9.240 N Rcor1 n/a
8 TRCN0000071369 CGCAGTCAAGAACGAGACAAT pLKO.1 166 CDS 100% 4.950 3.465 N Rcor1 n/a
9 TRCN0000301883 CGCAGTCAAGAACGAGACAAT pLKO_005 166 CDS 100% 4.950 3.465 N Rcor1 n/a
10 TRCN0000071372 GTCTCCATCAAACGACAGATT pLKO.1 826 CDS 100% 4.950 3.465 N Rcor1 n/a
11 TRCN0000331586 GTCTCCATCAAACGACAGATT pLKO_005 826 CDS 100% 4.950 3.465 N Rcor1 n/a
12 TRCN0000146866 CGCTTCAACATAGATGAAGTT pLKO.1 1078 CDS 100% 0.495 0.347 N RCOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.