Transcript: Mouse NM_198111.2

Mus musculus A kinase (PRKA) anchor protein 6 (Akap6), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Akap6 (238161)
Length:
10263
CDS:
95..7018

Additional Resources:

NCBI RefSeq record:
NM_198111.2
NBCI Gene record:
Akap6 (238161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363488 AGGATATTTGCGAGGATATTT pLKO_005 423 CDS 100% 15.000 21.000 N Akap6 n/a
2 TRCN0000088750 CCTCAAACAAACGGAGGTGTT pLKO.1 1993 CDS 100% 4.050 5.670 N Akap6 n/a
3 TRCN0000363530 AGTTGGTTGACATCCTATAAG pLKO_005 4874 CDS 100% 13.200 10.560 N Akap6 n/a
4 TRCN0000088751 CGCCGAGAAACAACTCCAATA pLKO.1 3427 CDS 100% 10.800 8.640 N Akap6 n/a
5 TRCN0000088752 GCCTGGTCCTTGTGAAATGAT pLKO.1 1174 CDS 100% 5.625 4.500 N Akap6 n/a
6 TRCN0000363471 CCAAATTGATGGTCCATTAAA pLKO_005 7367 3UTR 100% 15.000 10.500 N Akap6 n/a
7 TRCN0000088748 CCCTTGATTTGATTGTAGTAT pLKO.1 7505 3UTR 100% 5.625 3.938 N Akap6 n/a
8 TRCN0000088749 GCCTTTCACTACCAAATGATA pLKO.1 3165 CDS 100% 5.625 3.938 N Akap6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.