Transcript: Mouse NM_198170.4

Mus musculus seizure threshold 2 (Szt2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Szt2 (230676)
Length:
10958
CDS:
75..10370

Additional Resources:

NCBI RefSeq record:
NM_198170.4
NBCI Gene record:
Szt2 (230676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198170.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177521 CTTTGGCCGTAATCACATTTA pLKO.1 9332 CDS 100% 13.200 18.480 N Szt2 n/a
2 TRCN0000436802 ACCTAAGTGAGCCCGAGTTTC pLKO_005 4252 CDS 100% 10.800 15.120 N Szt2 n/a
3 TRCN0000445586 TTAGACCCTGGTCCGGAAATT pLKO_005 4296 CDS 100% 13.200 10.560 N Szt2 n/a
4 TRCN0000183364 GACTTGGACATCTACTTGTAT pLKO.1 6894 CDS 100% 5.625 4.500 N SZT2 n/a
5 TRCN0000421315 TGATTGAATCATGGATCTATA pLKO_005 10392 3UTR 100% 13.200 9.240 N Szt2 n/a
6 TRCN0000176878 GCTAGAGGTTACAGATAAGAA pLKO.1 8024 CDS 100% 5.625 3.938 N Szt2 n/a
7 TRCN0000198959 GCACTCCTTCAGCTATGACTT pLKO.1 9197 CDS 100% 4.950 3.465 N Szt2 n/a
8 TRCN0000197836 GTTGATTGAATCATGGATCTA pLKO.1 10390 3UTR 100% 4.950 3.465 N Szt2 n/a
9 TRCN0000176951 GTTGGACATTACCATTGAGAT pLKO.1 10686 3UTR 100% 4.950 3.465 N Szt2 n/a
10 TRCN0000198989 GCTTCAGTTCTTTGTGGTGCT pLKO.1 9635 CDS 100% 2.160 1.512 N Szt2 n/a
11 TRCN0000198609 CTGCAGCAATACGTGCAGTAT pLKO.1 8820 CDS 100% 0.495 0.347 N Szt2 n/a
12 TRCN0000181235 CCGTGTCTTTGAGCAGCATTT pLKO.1 7793 CDS 100% 10.800 6.480 N Szt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198170.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.