Transcript: Human NM_198379.3

Homo sapiens calcium voltage-gated channel subunit alpha1 G (CACNA1G), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
CACNA1G (8913)
Length:
8365
CDS:
746..7642

Additional Resources:

NCBI RefSeq record:
NM_198379.3
NBCI Gene record:
CACNA1G (8913)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430515 TCCGAATCAGAGCCCGATTTC pLKO_005 3671 CDS 100% 10.800 15.120 N CACNA1G n/a
2 TRCN0000436241 CTCCTCCTCCTGGGCTATATT pLKO_005 7694 3UTR 100% 15.000 10.500 N CACNA1G n/a
3 TRCN0000418347 TGCTGAGTCTCTCCGGTTTAT pLKO_005 7593 CDS 100% 13.200 9.240 N CACNA1G n/a
4 TRCN0000068937 CGACATCATGTACTTTGTGAT pLKO.1 1816 CDS 100% 4.950 3.465 N Cacna1g n/a
5 TRCN0000044239 CGCCCTAGAAATCAGCAACAT pLKO.1 3064 CDS 100% 4.950 3.465 N CACNA1G n/a
6 TRCN0000044242 GCACAAGTACAACTTTGACAA pLKO.1 5068 CDS 100% 4.950 3.465 N CACNA1G n/a
7 TRCN0000044240 GCCTTTGATGACTTCATCTTT pLKO.1 1100 CDS 100% 5.625 3.375 N CACNA1G n/a
8 TRCN0000044241 GCCTATCTACTTTGTGTCCTT pLKO.1 6124 CDS 100% 2.640 1.584 N CACNA1G n/a
9 TRCN0000044238 GCCATCAACTTTGACAACATT pLKO.1 1745 CDS 100% 5.625 2.813 Y CACNA1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.