Transcript: Mouse NM_198420.2

Mus musculus Rho GTPase activating protein 39 (Arhgap39), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Arhgap39 (223666)
Length:
4494
CDS:
261..3497

Additional Resources:

NCBI RefSeq record:
NM_198420.2
NBCI Gene record:
Arhgap39 (223666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097184 CGACAGAACTAAGTTTGCTAA pLKO.1 4104 3UTR 100% 4.950 3.960 N Arhgap39 n/a
2 TRCN0000097187 CCACAGAACTGCGACATCATT pLKO.1 549 CDS 100% 5.625 3.938 N Arhgap39 n/a
3 TRCN0000097185 GCGATGGAACTCTGGTAACAA pLKO.1 863 CDS 100% 5.625 3.938 N Arhgap39 n/a
4 TRCN0000097188 CCTCGCGTCATCTTCGAGAAT pLKO.1 3402 CDS 100% 4.950 3.465 N Arhgap39 n/a
5 TRCN0000097186 CCTCATGAATTCTACGAACAA pLKO.1 3180 CDS 100% 0.000 0.000 N Arhgap39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.