Transcript: Human NM_198530.4

Homo sapiens matrix remodeling associated 7 (MXRA7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MXRA7 (439921)
Length:
1833
CDS:
20..532

Additional Resources:

NCBI RefSeq record:
NM_198530.4
NBCI Gene record:
MXRA7 (439921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198530.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144368 CCAGGAATTTACTTGACCATT pLKO.1 1115 3UTR 100% 4.950 6.930 N MXRA7 n/a
2 TRCN0000143486 GCTGGGATCTAATTGACACAA pLKO.1 1655 3UTR 100% 4.950 6.930 N MXRA7 n/a
3 TRCN0000144451 CCAAACTCATTTGCAGTTCTT pLKO.1 1387 3UTR 100% 4.950 3.465 N MXRA7 n/a
4 TRCN0000144505 CTTTGAGGAATGAGAGACAAA pLKO.1 951 3UTR 100% 4.950 3.465 N MXRA7 n/a
5 TRCN0000145017 GATCATCAGATCAGTCTCAAA pLKO.1 1324 3UTR 100% 4.950 3.465 N MXRA7 n/a
6 TRCN0000145512 GTAGAGATGTTCATGTCTGTT pLKO.1 736 3UTR 100% 4.950 3.465 N MXRA7 n/a
7 TRCN0000145339 GTACAAGAAGATGATGACCAA pLKO.1 475 CDS 100% 2.640 1.848 N MXRA7 n/a
8 TRCN0000143794 GAGAAGGCTTCTCCTTCAAAT pLKO.1 426 CDS 100% 1.320 0.924 N MXRA7 n/a
9 TRCN0000144202 CAAGAAGATGATGACCAAAGA pLKO.1 478 CDS 100% 4.950 2.970 N MXRA7 n/a
10 TRCN0000145190 GAAACCAGTACAAGAAGATGA pLKO.1 468 CDS 100% 4.950 2.970 N MXRA7 n/a
11 TRCN0000141839 GAGGAGCAGAGAACTGAAGAA pLKO.1 509 CDS 100% 4.950 2.970 N MXRA7 n/a
12 TRCN0000142593 GATGATGACCAAAGAGGAGCT pLKO.1 484 CDS 100% 2.160 1.296 N MXRA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198530.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.