Transcript: Human NM_198582.4

Homo sapiens kelch like family member 30 (KLHL30), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KLHL30 (377007)
Length:
3780
CDS:
162..1898

Additional Resources:

NCBI RefSeq record:
NM_198582.4
NBCI Gene record:
KLHL30 (377007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198582.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156018 CCCTCAAATACGTCAGCAACT pLKO.1 1384 CDS 100% 4.050 5.670 N KLHL30 n/a
2 TRCN0000424901 GGAACTTTGCCTTCTACAACA pLKO_005 1039 CDS 100% 4.950 3.465 N KLHL30 n/a
3 TRCN0000153373 GTCAGAACAAAGGCTCTTCAT pLKO.1 2673 3UTR 100% 4.950 3.465 N KLHL30 n/a
4 TRCN0000429807 CAAAGACAGACACCTGGTCAA pLKO_005 1171 CDS 100% 4.050 2.835 N KLHL30 n/a
5 TRCN0000060503 CCTCTCAAGTAGCTGGGATTA pLKO.1 3321 3UTR 100% 10.800 5.400 Y NCCRP1 n/a
6 TRCN0000155576 CCTCTCAAGTAGCTGGGATTA pLKO.1 3321 3UTR 100% 10.800 5.400 Y KLHL30 n/a
7 TRCN0000165697 CCTCTCAAGTAGCTGGGATTA pLKO.1 3321 3UTR 100% 10.800 5.400 Y SLC48A1 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3459 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3459 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198582.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.