Transcript: Mouse NM_198608.2

Mus musculus alanyl-tRNA synthetase 2, mitochondrial (Aars2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Aars2 (224805)
Length:
3368
CDS:
14..2956

Additional Resources:

NCBI RefSeq record:
NM_198608.2
NBCI Gene record:
Aars2 (224805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075975 GTGGCCTCCTATTAGATAGAA pLKO.1 1662 CDS 100% 5.625 4.500 N Aars2 n/a
2 TRCN0000075973 CCACCAGGAGACTGTAAGAAA pLKO.1 3097 3UTR 100% 5.625 3.938 N Aars2 n/a
3 TRCN0000222696 CAGCTGGTAGAGCTTTGGAAT pLKO.1 704 CDS 100% 4.950 3.465 N Aars2 n/a
4 TRCN0000075974 CCCAAGTATAACTACACTCTT pLKO.1 1538 CDS 100% 4.950 3.465 N Aars2 n/a
5 TRCN0000075976 TGAGAAGAACTCAGTCAAGAT pLKO.1 1168 CDS 100% 4.950 2.970 N Aars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.