Transcript: Mouse NM_198610.2

Mus musculus immunoglobulin superfamily, member 21 (Igsf21), mRNA.

Source:
NCBI, updated 2019-02-22
Taxon:
Mus musculus (mouse)
Gene:
Igsf21 (230868)
Length:
2017
CDS:
441..1847

Additional Resources:

NCBI RefSeq record:
NM_198610.2
NBCI Gene record:
Igsf21 (230868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232890 GCTACCTGACAGTCAACATTG pLKO_005 511 CDS 100% 10.800 15.120 N IGSF21 n/a
2 TRCN0000112600 CGGATTTCAGAATGAGGTCTT pLKO.1 1532 CDS 100% 4.050 5.670 N Igsf21 n/a
3 TRCN0000112602 GCACATGGAGAATTACCGCAA pLKO.1 692 CDS 100% 2.160 3.024 N Igsf21 n/a
4 TRCN0000232892 AGGTCCGGATCTCAGACAATG pLKO_005 754 CDS 100% 10.800 7.560 N IGSF21 n/a
5 TRCN0000112603 GCGCCCATGGTTTATTTCAAA pLKO.1 972 CDS 100% 5.625 3.938 N Igsf21 n/a
6 TRCN0000112601 CGAGACGTGGATGATACCAAA pLKO.1 1092 CDS 100% 4.950 3.465 N Igsf21 n/a
7 TRCN0000112604 TCAGGCAACATCTTCCTCAAT pLKO.1 837 CDS 100% 4.950 3.465 N Igsf21 n/a
8 TRCN0000180559 GATCTCAGACAATGGTCCCTA pLKO.1 761 CDS 100% 2.640 1.848 N IGSF21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.