Transcript: Mouse NM_198634.1

Mus musculus tigger transposable element derived 3 (Tigd3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tigd3 (332359)
Length:
2147
CDS:
153..1565

Additional Resources:

NCBI RefSeq record:
NM_198634.1
NBCI Gene record:
Tigd3 (332359)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125066 CGCTGGAAACGTCGAAACAAT pLKO.1 528 CDS 100% 5.625 7.875 N Tigd3 n/a
2 TRCN0000125068 GATCGGTTGCAAGTACTGTTA pLKO.1 729 CDS 100% 4.950 6.930 N Tigd3 n/a
3 TRCN0000125065 CGTCGAAACAATGTGGGCTTT pLKO.1 537 CDS 100% 4.050 3.240 N Tigd3 n/a
4 TRCN0000125067 ACGTCGAAACAATGTGGGCTT pLKO.1 536 CDS 100% 2.160 1.728 N Tigd3 n/a
5 TRCN0000125064 CTTAGTCTAAATAGGGTAGAA pLKO.1 1813 3UTR 100% 4.950 2.970 N Tigd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.